View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6191_low_39 (Length: 246)
Name: NF6191_low_39
Description: NF6191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6191_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 37324328 - 37324094
Alignment:
| Q |
1 |
tacatttattattattttcttcttgtcaaactctcacccaatgtgaaaggcaaaccaatgaaataaacattgtaataccacgttggttattaaattcagt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37324328 |
tacatttattattattttgttcttgtcaaactctcacccaatgtgaaaggcaaaccgatgaaataaacattgtaataccacattggttattaaattcagt |
37324229 |
T |
 |
| Q |
101 |
atacatttttaatttttgtcactttaatataccactaaagaa----atatcttcagactcattatagtgtttcctccaaagggacaaaggaccattattt |
196 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37324228 |
atacattgttaattattgtcactttaatataccactaaagaaatagatatcttcagactcattatagtgtttcctccaaagggacaaaggaccattattt |
37324129 |
T |
 |
| Q |
197 |
gaattgctagcattgtgacttgtgagtctcgtgat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37324128 |
gaattgctagcattgtgacttgtgagtctcgtgat |
37324094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University