View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6191_low_46 (Length: 229)
Name: NF6191_low_46
Description: NF6191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6191_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 30 - 214
Target Start/End: Original strand, 15150913 - 15151096
Alignment:
| Q |
30 |
attgtatgcgtgttaaaaaactgggtgttacaaactattcaagttttgtataattgatctatttatatggatgataagtatttaatatattgatgaagan |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15150913 |
attgtatgcgtgttaaaaaactgggtgttacaaacgattcaagttttgtataattgacctatttatatggatgataagtatttaatatattgatgaagat |
15151012 |
T |
 |
| Q |
130 |
nnnnnnattactataatattgatattgatgaggatatgattttgttagtgataatattttaattacacattcgacaatatttatg |
214 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15151013 |
ttttttattactat-atattgatattgatgaggatatgattctgttagtgataatattttaattacacattcgacaatatttatg |
15151096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University