View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6191_low_47 (Length: 227)
Name: NF6191_low_47
Description: NF6191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6191_low_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 7 - 209
Target Start/End: Original strand, 43188849 - 43189051
Alignment:
| Q |
7 |
atatataggcatttcatcatttattattcaagnnnnnnnggtaggaggaaagggtatttattattatagtatatggttcaacagttttaagcattacaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43188849 |
atatataggcatttcatcatttattattcaagaaaaaaaggtaggaggaaagggtatttattattatagtatatggttcaacagttttaagcattacaat |
43188948 |
T |
 |
| Q |
107 |
atggnnnnnnngggaaaagataaggcttttgggtcagcttgagaattcagagaacagttttgaatctaaattctcaactgaattcattgaatattttatt |
206 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43188949 |
atggttttttttggaaaagataaggcttttgggtcagcttgagaattcagagaacagttttgaatctaaattctcaactgaattcattgaatattttatt |
43189048 |
T |
 |
| Q |
207 |
atc |
209 |
Q |
| |
|
||| |
|
|
| T |
43189049 |
atc |
43189051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University