View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6192_high_16 (Length: 241)
Name: NF6192_high_16
Description: NF6192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6192_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 222
Target Start/End: Original strand, 7970155 - 7970364
Alignment:
| Q |
13 |
tagtaaccaaccggatgataatagtgctcgtcgttcttgaagctcattgttgattctatacaacaaaggatgtgaagtgagcatgcaacaactacttgga |
112 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7970155 |
tagtaaccaactggatgataatagtgctcctcgttcttgaagctcattgttgattctatacaacaaaggatgtgaagtgagcaagcaacaactacttgga |
7970254 |
T |
|
| Q |
113 |
gaggtccaaggatatatattctgcatagcaattatcatatcaaatatcaatacgccaaagctcattgtattttatactctgctagccaaggtgagcgagt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7970255 |
gaggtccaaggatatatattctgcatagcaattatcatatcaaatatcaatatgccaaagctcattgtattttatactctgctagccaaggtgagcgagt |
7970354 |
T |
|
| Q |
213 |
acattcatgt |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
7970355 |
acattcatgt |
7970364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University