View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6192_low_19 (Length: 236)
Name: NF6192_low_19
Description: NF6192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6192_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 2993868 - 2994077
Alignment:
| Q |
1 |
caatttgacgtgtatgaagcaaaagagaatttagaatgttccattccattacatgtttttcaccaacttaatta----gcttaggatgtttcttgtattt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2993868 |
caatttgacgtgtatgaagcaaaagagaatttagaatgttccatt-----acatgtttttcaccaacttaattaattagcttaggatgtttcttgtattt |
2993962 |
T |
 |
| Q |
97 |
atttagtcaaaattattactgttttatatgtcgactatatggttgctgtaataccatgaactggaaatattaaggttagatatttttaatttaaggttat |
196 |
Q |
| |
|
| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || || |
|
|
| T |
2993963 |
a----gtgaaaattattactgttttatatgtcgactatatggttgctgtaataccatgaactgg----attaaggttagatatttttaatttaaagtaat |
2994054 |
T |
 |
| Q |
197 |
aattttcagattaatcatattct |
219 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
2994055 |
aatattcagattaatcatattct |
2994077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University