View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6193_high_9 (Length: 222)
Name: NF6193_high_9
Description: NF6193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6193_high_9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 2 - 222
Target Start/End: Original strand, 267273 - 267493
Alignment:
| Q |
2 |
catcaacggtcttttaacttaatttaaagtttctaacaggttgtttatcttgttttcggttcaaattaatcttgctttaccaaaaacgaaaagcgcaatt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
267273 |
catcaacggtcttttaacttaatttaaagtttctaacaggttgtttatcttgttttcggttcaaattaatcttgctttaccaaaaacgaaaagcgcaatt |
267372 |
T |
 |
| Q |
102 |
tgtccaagccaggttgttcacttcgtggtgtgctataattatctctctatcatatcatatcatgtcaatcacagtgaagcaaacacaatgtcaagttcaa |
201 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
267373 |
tgtccaagccaggttgttcacttcttggtgtgctataattatctctctatcatatcatatcatgtcaatcacaatgaagcaaacacaatgtcaagttcaa |
267472 |
T |
 |
| Q |
202 |
attccaacctacactcacgct |
222 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
267473 |
agtccaacctacactcacgct |
267493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University