View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6193_low_12 (Length: 283)
Name: NF6193_low_12
Description: NF6193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6193_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 138 - 266
Target Start/End: Complemental strand, 1322280 - 1322152
Alignment:
| Q |
138 |
acaataggtctcaatgtaacttttttaatagaagttttggtaggggacaaagaagagagactaaagccgtttatggaagaggtagacattgtgacaatga |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1322280 |
acaataggtctcaatgtaacttttttaatagaagtttttgtaggggacaaagaagagagactaaagccgtttatggaagaggtagacattgtgacaatga |
1322181 |
T |
|
| Q |
238 |
agactcaaatcacaatgctatatagctat |
266 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1322180 |
agactcaaatcacaatgctatatagctat |
1322152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 17 - 79
Target Start/End: Complemental strand, 1322401 - 1322339
Alignment:
| Q |
17 |
atataccaaaactggggtgatgataggagaagaagatgaagcaaaaacaggcttgtcttgaat |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1322401 |
atataccaaaactggggtgatgataggagaagaagatgaagcaaaaacaggcttgtcttgaat |
1322339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University