View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6193_low_19 (Length: 228)
Name: NF6193_low_19
Description: NF6193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6193_low_19 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 27962359 - 27962130
Alignment:
| Q |
1 |
cgcatggattctgacctctgcaaaattaaaa-----agttgtaaaaattgtatggacagtgagacattaatggcgtatgaaaatttgttacttaaatttg |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27962359 |
cgcatggattctgacctctgcaaaattaaaataaaaagttgtaaaatttgtatggacagtgagacattaatggcgtatgaaaatttgttacttaaatttg |
27962260 |
T |
 |
| Q |
96 |
gaaaggagataagtttatctcagaacatcagtaaaatcaaggttgcattgcaaaatttattccgaatgttaaaaaggggacaacatatggcatctcaaag |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27962259 |
gaaaggagataagtttatctcagaacatcagtaaagtcaaggttgcattgcaaaat---ttccgaatgttaaaaaggggacagcatatggcatctcaaag |
27962163 |
T |
 |
| Q |
196 |
tcaaatatactaaccatcaacttcaattgatga |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
27962162 |
tcaaatatactaaccatcaacttcaattgatga |
27962130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University