View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6194_low_2 (Length: 355)

Name: NF6194_low_2
Description: NF6194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6194_low_2
NF6194_low_2
[»] chr4 (2 HSPs)
chr4 (145-344)||(51844214-51844413)
chr4 (17-52)||(51844506-51844541)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 145 - 344
Target Start/End: Complemental strand, 51844413 - 51844214
Alignment:
145 cttggaattgggtagccacaaacggaaacatgaaagttgtcatcgtgtgtgagaacagattggtgatggaggcttcaacttttagaattaccaatattgg 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51844413 cttggaattgggtagccacaaacggaaacatgaaagttgtcatcgtgtgtgagaacagattggtgatggaggcttcaacttttagaattaccaatattgg 51844314  T
245 attttaattctaattatagttaaatttacaattggattgaattcattcagannnnnnngctatttttaacatcttctattcgttgaccggctaccttcat 344  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||       ||||||||||||||||||||||||||||||||||||||||||    
51844313 attttaattctaattatagttaaatttacaattggattcaattcattcagatttttttgctatttttaacatcttctattcgttgaccggctaccttcat 51844214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 17 - 52
Target Start/End: Complemental strand, 51844541 - 51844506
Alignment:
17 gtttgtagaaatggaccgctgttcggagagatagag 52  Q
    ||||||||||||||||||||||||||||||||||||    
51844541 gtttgtagaaatggaccgctgttcggagagatagag 51844506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University