View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6195_low_4 (Length: 296)
Name: NF6195_low_4
Description: NF6195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6195_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 278
Target Start/End: Complemental strand, 24201220 - 24200961
Alignment:
| Q |
13 |
catcatcattattaccactagaatccccggcttcaaaccatgaatctataattaacctgcagaattcacaaccactaccaccaccaccaccgccattacc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24201220 |
catcatcattattaccactagaatccccggcttcaaaccatgaatctataattaacctgcagaattcacaaccactaccaccaccaccaccgccattacc |
24201121 |
T |
|
| Q |
113 |
aacgcatggccacgcatgggactactttgatcctttcctttctttgaccacgcatggccagcctgatgatgacgacgatcatagtcagttccttcgaagt |
212 |
Q |
| |
|
||||| | | ||||||||| |||| || |||||| |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
24201120 |
aacgctag---atccatgggacttctttaatactttcccttctttgaccacgcatggccggcc---tgatgacgacgatcatagtcagttccttcgaaat |
24201027 |
T |
|
| Q |
213 |
catatggtgaaaatctcaaagttgcatttaaaagatgatgtctctcactgtcctatttgcatggag |
278 |
Q |
| |
|
|| || ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24201026 |
cacattgtgaaaatctcaaagctgcatttaaaagatgatgtctctcactgtcctatttgcatggag |
24200961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University