View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6197_high_20 (Length: 308)
Name: NF6197_high_20
Description: NF6197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6197_high_20 |
 | |
|
| [»] scaffold0009 (2 HSPs) |
| | |
|
| [»] scaffold0031 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 47650061 - 47649908
Alignment:
| Q |
1 |
atgtatttatattttgtgatgatgaaaatttgcttttagagagatcctgaaaccaaaaaggagcccaactataaggatttatggagaatgactcgcacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47650061 |
atgtatttatattttgtgatgatgaaaatttgcttttagagagatcctgaaaccaaaaaggagcccaactataaggatttatggagaatgactcgcacaa |
47649962 |
T |
|
| Q |
101 |
acagcaatggagatggataaatgatgcttctaaggaagttcatgtatgacatcc |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47649961 |
acagcaatggagatggataaatgatgcttctaaggaagttcatgtatgacatcc |
47649908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 230 - 299
Target Start/End: Complemental strand, 47649832 - 47649763
Alignment:
| Q |
230 |
atagacgaaggttgaagaaacttcttcagtttacttacaagctggatatggggacactgatgatgatgtc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
47649832 |
atagacgaaggttgaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtc |
47649763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 170762 - 170916
Alignment:
| Q |
1 |
atgtatttatattttgtgatgatgaaaatttgcttttagagagatcctgaaaccaaaaaggagcccaactataaggatttatggagaatgactcgcacaa |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
170762 |
atgtatttatattttgcaatgatgaaaatttgcttttagagagatcccgaaaccaaaaaggaggctaactataaggatttatggagaatgactcacacaa |
170861 |
T |
|
| Q |
101 |
acagcaatggag-atggataaatgatgcttctaaggaagttcatgtatgacatcc |
154 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
170862 |
acagcaatggagaatggataaatgatgcttctaaggaagttcatgtatggcatcc |
170916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 236 - 290
Target Start/End: Original strand, 170995 - 171049
Alignment:
| Q |
236 |
gaaggttgaagaaacttcttcagtttacttacaagctggatatggggacactgat |
290 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
170995 |
gaaggttgaagaaacttcttcagttttcttacaagctggatatgaggacactgat |
171049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 99; Significance: 7e-49; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 92220 - 92066
Alignment:
| Q |
1 |
atgtatttatattttgtgatgatgaaaatttgcttttagagagatcctgaaaccaaaaaggagcccaactataaggatttatggagaatgactcgcacaa |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||| ||||||||| ||||||||||||||||||||||||||||| || || |
|
|
| T |
92220 |
atgtatttatattttgtgacgatgaaaatttgcttttagagagatcttgaaactgaaaaggagcacaactataaggatttatggagaatgactcacataa |
92121 |
T |
|
| Q |
101 |
acagcaatggag-atggataaatgatgcttctaaggaagttcatgtatgacatcc |
154 |
Q |
| |
|
||| ||| |||| |||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
92120 |
acaacaacggagaatggataaatgatgcttctaagaatattcatgtatgacatcc |
92066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 113 - 153
Target Start/End: Complemental strand, 30754116 - 30754076
Alignment:
| Q |
113 |
atggataaatgatgcttctaaggaagttcatgtatgacatc |
153 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30754116 |
atggataaatgacgcttctaaggaagttcatgtatgacatc |
30754076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 44
Target Start/End: Complemental strand, 30754190 - 30754153
Alignment:
| Q |
7 |
ttatattttgtgatgatgaaaatttgcttttagagaga |
44 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30754190 |
ttatattttgtgatgatgaaaatatgcttttagagaga |
30754153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University