View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6197_high_30 (Length: 251)
Name: NF6197_high_30
Description: NF6197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6197_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 4074349 - 4074099
Alignment:
| Q |
1 |
tctaggaaaactgaatgtaaagtagaagacaacaattttaatattgtatttcatgaacaatttggaccccaaattatattttgaattattatataagaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4074349 |
tctaggaaaactgaatgtaaagtagaagacaacaattttgatattgtatttcatgaacaatttggaccccaaattatattttgaattattatataagaaa |
4074250 |
T |
 |
| Q |
101 |
gtttatacctctttctccttcttccttaaccatttcttctaattgatagagagtgtcaagttgtttcaaagctatttactttagtg--------tcaag- |
191 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| || ||| | |
|
|
| T |
4074249 |
gtttatacttctttctccttcttccttaaccatttcttctaattgatatagagtgtcaagttgtttcaaagctatttacgttaatgtctcatcttcacgt |
4074150 |
T |
 |
| Q |
192 |
ttgttgaaattttttgatttaggggactagcttgtgtcggtttattttctt |
242 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4074149 |
ttgttgaatttttttgatttaggggactagcttgtgtcggtttattttctt |
4074099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University