View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6197_high_35 (Length: 238)
Name: NF6197_high_35
Description: NF6197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6197_high_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 2 - 223
Target Start/End: Original strand, 4074365 - 4074594
Alignment:
| Q |
2 |
aaaaaagggagcatctatgcttctaaaaacttcaactttaggtgcttc----------caggaggtaaattaagtctagcaaatgattgttccagttggg |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4074365 |
aaaaaagggagcatctatgcttctaaaaacttcaactttaggtgcttcaaagtttggtcaggaggtaaattaagtctagcaaatgattgttccagttggg |
4074464 |
T |
|
| Q |
92 |
atatgaacttctactatcgatttgtcaatctctgtgttactaagcaaggttccacccaatatggtagtccgcgactattcaaagtctcgttctagttttc |
191 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4074465 |
atatgaacttctcctatcgatttgtcaatctctgtgttactaagcaaggttccaccca--atggtagtccgcgactattcaaagtctcgttctagttttc |
4074562 |
T |
|
| Q |
192 |
aagatgggacaaaaatttcggcttttagtttt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4074563 |
aagatgggacaaaaatttcggcttttagtttt |
4074594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University