View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6197_high_41 (Length: 213)
Name: NF6197_high_41
Description: NF6197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6197_high_41 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 97 - 213
Target Start/End: Original strand, 43193951 - 43194067
Alignment:
| Q |
97 |
cccacttcaattgagatcaaaactttcagataatctagccaaaacaaacttttttaactcatctgaacgattcaatctcaaattattagacagcatcatc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43193951 |
cccacttcaattgagatcaaaactttcagataatctagccaaaacaaacttttttaactcatctgaacgattcaatctcaaattattagacagcatcatt |
43194050 |
T |
|
| Q |
197 |
aacaccaagaaccaaat |
213 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43194051 |
aacaccaagaaccaaat |
43194067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University