View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6197_high_9 (Length: 385)
Name: NF6197_high_9
Description: NF6197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6197_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 9e-49; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 72 - 212
Target Start/End: Original strand, 35248366 - 35248507
Alignment:
| Q |
72 |
tagcgagtgaccatgcagagtcatgcataacaagaaaatcttttcatttttatactgt-gcggttaagtgtctggttagnnnnnnnnngttggtttcttt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |||||||| ||| |
|
|
| T |
35248366 |
tagcgagtgaccatgcagagtcatgcataacaagaaaatcttttcatttttatactgtggcggttaagtgtgtggttagtttttttttgttggtttgttt |
35248465 |
T |
|
| Q |
171 |
ttggattgtcacatatataattcacaattcccgttggtacgc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35248466 |
ttggattgtcacatatataattcacaattcccgttggtacgc |
35248507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 72 - 149
Target Start/End: Original strand, 35254864 - 35254942
Alignment:
| Q |
72 |
tagcgagtgaccatgcagagtcatgcataacaagaaaatcttttcatttttatactgt-gcggttaagtgtctggttag |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
35254864 |
tagcgagtgaccatgcagagtcatgcataacaagaaaatcttttcatttttatactgtggcggttaagtgtgtggttag |
35254942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 211 - 244
Target Start/End: Original strand, 35248532 - 35248565
Alignment:
| Q |
211 |
gcaacatgaaaagaatccggtacataggaagata |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35248532 |
gcaacatgaaaagaatccggtacataggaagata |
35248565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 256 - 296
Target Start/End: Original strand, 35248593 - 35248633
Alignment:
| Q |
256 |
gtactagtattatctaattaagtaaagtaatttatcaatac |
296 |
Q |
| |
|
|||| ||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
35248593 |
gtaccagtattacctaattaagtaaagtaagttatcaatac |
35248633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University