View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6197_low_3 (Length: 620)
Name: NF6197_low_3
Description: NF6197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6197_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-103; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 376 - 609
Target Start/End: Original strand, 33887493 - 33887720
Alignment:
| Q |
376 |
ctgaagaattggaaaagggaaactcatttcgagaatacagaattttgagaaacaaacctctggatctaacggtgtagtgtcgagctccttaacgtcatcg |
475 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33887493 |
ctgaggaattggaaaagggaaactcatttcgagaatacagaattttgagaaacaaacctctggatctaacggtgtagtgtcgagctccttaacgtc---- |
33887588 |
T |
|
| Q |
476 |
tcgtcggtttcagtaaccttgccggagctgcagcaagtcaacagcggagtgtgatcggagcgaaactcgtcagaagccgacgaaagaatattttctgcag |
575 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33887589 |
--gttggtttcagtaaccttgccggagctgcagcaagtcaacagcggagtgtgatccgagcgaaactcgtcggaagccgacgaaagaatattttctgcag |
33887686 |
T |
|
| Q |
576 |
cttcagcgagcgagtttggtagttgatgcttcat |
609 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
33887687 |
cttcagctagcgagtttggtagttgatgcttcat |
33887720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 214 - 304
Target Start/End: Original strand, 33887347 - 33887437
Alignment:
| Q |
214 |
tacctgaacgattttaaattgtggttggttttgtctaccgtttcaaaacacttagttttcagctgcaagatcatcacagtaattcacaaat |
304 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33887347 |
tacctgaacgattttaaattgtggttcgttttgtctaccgtttcaaaacacttagttttcagctgcaagatcatcacagtaattcacaaat |
33887437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 19 - 108
Target Start/End: Original strand, 33887171 - 33887260
Alignment:
| Q |
19 |
agttttattatattcttacttctcagcaaatctcttccgctcttccctctcaaaatttgcaaagaattcatcaatctcctcttccctgaa |
108 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
33887171 |
agttttattatatacttacttctcagcaaatctcttccgctcttccctctcaaaatttgcaaagaattcatcaatctccgcctccctgaa |
33887260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University