View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6197_low_42 (Length: 218)
Name: NF6197_low_42
Description: NF6197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6197_low_42 |
 |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
| [»] scaffold0094 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 16 - 201
Target Start/End: Complemental strand, 30053 - 29869
Alignment:
| Q |
16 |
aatatacaactttgaagactcgctttactatagtatcttggttggtttctagcctccaaccttgcttccctagcatacccaaattaaatccgtacagatg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30053 |
aatatacaactttgaagactcgctttactatagtatcttggttggtttctagcctccaaccttgcttccctagcatacccaaattaaatctgtacagatg |
29954 |
T |
 |
| Q |
116 |
tnnnnnnnctcataccattgtgttcttttctcatagctagcttgtcccattttagcaaatttattcgttttccatcatttgtattt |
201 |
Q |
| |
|
| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29953 |
t-aaaaaactcataccactgtgttcttttctcatagctagcttgtcccattttagcaaatttattcgttttccatcatttgtattt |
29869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 26 - 105
Target Start/End: Original strand, 10162143 - 10162222
Alignment:
| Q |
26 |
tttgaagactcgctttactatagtatcttggttggtttctagcctccaaccttgcttccctagcatacccaaattaaatc |
105 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| | ||||||| ||||||| ||| |||| ||||| |||||| |
|
|
| T |
10162143 |
tttgaagactcgcgctactatagtatcttggttggtttcagggctccaacattgcttctctaacatagccaaaataaatc |
10162222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 44 - 91
Target Start/End: Complemental strand, 8297070 - 8297023
Alignment:
| Q |
44 |
tatagtatcttggttggtttctagcctccaaccttgcttccctagcat |
91 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
8297070 |
tatagtatcatggttggtttctaacctccaaccttgcttcccaagcat |
8297023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 42 - 103
Target Start/End: Original strand, 15162326 - 15162386
Alignment:
| Q |
42 |
actatagtatcttggttggtttctagcctccaaccttgcttccctagcatacccaaattaaa |
103 |
Q |
| |
|
||||||||||| ||||||||||||| ||| ||||||||||||||||||| |||||||||| |
|
|
| T |
15162326 |
actatagtatcatggttggtttctaatctc-aaccttgcttccctagcattgccaaattaaa |
15162386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 92
Target Start/End: Complemental strand, 12168552 - 12168505
Alignment:
| Q |
45 |
atagtatcttggttggtttctagcctccaaccttgcttccctagcata |
92 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
12168552 |
atagtatcttggttggttagaagcttccaaccttgcttccctagcata |
12168505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0094 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0094
Description:
Target: scaffold0094; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 103
Target Start/End: Complemental strand, 13915 - 13881
Alignment:
| Q |
69 |
ctccaaccttgcttccctagcatacccaaattaaa |
103 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
13915 |
ctccaaccttgcttccctagcatagccaaattaaa |
13881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University