View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6197_low_43 (Length: 213)

Name: NF6197_low_43
Description: NF6197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6197_low_43
NF6197_low_43
[»] chr5 (1 HSPs)
chr5 (97-213)||(43193951-43194067)


Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 97 - 213
Target Start/End: Original strand, 43193951 - 43194067
Alignment:
97 cccacttcaattgagatcaaaactttcagataatctagccaaaacaaacttttttaactcatctgaacgattcaatctcaaattattagacagcatcatc 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
43193951 cccacttcaattgagatcaaaactttcagataatctagccaaaacaaacttttttaactcatctgaacgattcaatctcaaattattagacagcatcatt 43194050  T
197 aacaccaagaaccaaat 213  Q
    |||||||||||||||||    
43194051 aacaccaagaaccaaat 43194067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University