View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6199_high_11 (Length: 340)
Name: NF6199_high_11
Description: NF6199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6199_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 296; Significance: 1e-166; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 330
Target Start/End: Original strand, 4518567 - 4518893
Alignment:
| Q |
1 |
atttatctcatccacgtggagtcatgatacaaaaagatggagtagtattgataatataaaaagatcattgtttgcaaaacctctaggcttatatctaaga |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4518567 |
atttatctcatccacgtggggtcatgatacaaaaagatggagtagtattgataatataaaaagatcattgtttgcaaaacctctaggcttatatctaaga |
4518666 |
T |
|
| Q |
101 |
gattgttttggacgcgatatgtttgaagtccgttgagcaagaagttggcatgagtgggatcacggatagggtttttgcaatatccgtcatccttactatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4518667 |
gattgttttggacgcgatatgtttgaagtccgctgagcaagaagttggcatgagtgggatcacggatagggtttttgcaatattcgtcatccttactatg |
4518766 |
T |
|
| Q |
201 |
ttttcgaaatcaacttacacttttgatgattcccctcaactcaacgcacctcttttgattgtgtatgactatgagccacactatatcaagttgtagtttt |
300 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4518767 |
ttttcgaaatcaacttacacttt---tgattcccctcaactcaacgcacctcttttgattgtgtatgattatgagccacactatatcaagttgtagtttt |
4518863 |
T |
|
| Q |
301 |
tattaggctaaagtgcacttttcgtcccct |
330 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
4518864 |
tattaggctaaagtgcacttttcgccccct |
4518893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 101 - 162
Target Start/End: Original strand, 37863693 - 37863754
Alignment:
| Q |
101 |
gattgttttggacgcgatatgtttgaagtccgttgagcaagaagttggcatgagtgggatca |
162 |
Q |
| |
|
|||||||||| ||| ||| |||||||| || |||| |||||||||||||||||||||||| |
|
|
| T |
37863693 |
gattgttttgaacgtgatttgtttgaaatcgcctgagaaagaagttggcatgagtgggatca |
37863754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 293 - 323
Target Start/End: Complemental strand, 3227708 - 3227678
Alignment:
| Q |
293 |
gtagtttttattaggctaaagtgcacttttc |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3227708 |
gtagtttttattaggctaaagtgcacttttc |
3227678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University