View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6199_high_17 (Length: 265)

Name: NF6199_high_17
Description: NF6199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6199_high_17
NF6199_high_17
[»] chr5 (1 HSPs)
chr5 (43-239)||(1350678-1350875)


Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 43 - 239
Target Start/End: Complemental strand, 1350875 - 1350678
Alignment:
43 aacaacaacaagacgaaagcaaataataatgagtaaaatgaataggg-tgggttgcaactagatgacaaacctctgatatagcggaaatcaaagggtgta 141  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
1350875 aacaacaacaagacgaaagcaaataataatgagtaaaatgaataggggtgggttgcaactagatgacaaacctctgatatagcggaaatcaaagggtgta 1350776  T
142 tgcctagtgttttgagacagttctgagaacatggcgatgatagaaagtgagtgagtgacgcaaactggtgtctatgtcgtcgacggcaaaaggctggg 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1350775 tgcctagtgttttgagacagttctgagaacatggcgatgatagaaagtgagtgagtgacgcaaactggtgtctatgtcgtcgacggcaaaaggctggg 1350678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University