View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6199_high_18 (Length: 253)
Name: NF6199_high_18
Description: NF6199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6199_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 28204446 - 28204201
Alignment:
| Q |
1 |
acataattttcaacataaaaaatatcatttctctcaaatatagtttaagcttgtcatatgctgttatgttttttatgtactattatgttaagtacnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
28204446 |
acataattttcaacataaaaaatatcatttctctcaaatatagtttaagcttgtcatatgctgttatgttttttatgcactattatgctaagtacttttt |
28204347 |
T |
|
| Q |
101 |
nnn--gaagaaattatgttaagtacttgnnnnnnnaatcatacacacccatgatgatttgactggattaaagttaataatatggtggtgcaagggagtaa |
198 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28204346 |
tttttgaaggaattatgttaagtacttgtttttttaatcatacacacccatgatgatttgactggattaaagttaataatatggtggtgcaagggagtaa |
28204247 |
T |
|
| Q |
199 |
ctagcatactaggatgacgacaatggccgatgattgatcttcatct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
28204246 |
ctagcatactaggatgacgacaatggccgatgattgagcttgatct |
28204201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University