View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6199_high_6 (Length: 402)
Name: NF6199_high_6
Description: NF6199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6199_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 5 - 396
Target Start/End: Complemental strand, 2892288 - 2891897
Alignment:
| Q |
5 |
ccaccaaacacactcatggaatttgctttgaacatatagaacgaccttgatttttacgatgtttcgcttgtacaaggtttcaatattccaattcagttga |
104 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2892288 |
ccaccaaacacaatcatggaatttgctttgaacatgtataacgaccttgatttttacgatgtttcgcttgtacaaggtttcaatattccaattcagttaa |
2892189 |
T |
 |
| Q |
105 |
aaccgtctttaaattcttgtggtaccgttaattgtaccgcggatattaacggagagtgtcctactccacttaaggtaccaggtggatgtaacaatccttg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2892188 |
aaccgtctttaaattcttgtggtaccgttaattgtaccgccgatattaacggagagtgtcctactccacttaaggtaccaggtggatgtaacaatccttg |
2892089 |
T |
 |
| Q |
205 |
tactacgtttgatacaactgaatattgttgcaactccgattctgctagatctgcagctaccaatgcctctgccacatgtggtccaacaacttattctaag |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2892088 |
tactacgtttgatacaactgaatattgttgcaactctgattctgctagatctgcagctaccaatgcctctgccacatgtggtccaacaacttattctaag |
2891989 |
T |
 |
| Q |
305 |
ttctttaaggataggtgcccttatgcttatagttaccctaaagatgatgcaaccagcacattctcttgtatgggaggaacaactgatgatgt |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2891988 |
ttctttaaggataggtgcccttatgcttatagttaccctaaagatgatgcaaccagcacattctcttgtatgggaggaacaacttatgatgt |
2891897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University