View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6199_low_16 (Length: 281)
Name: NF6199_low_16
Description: NF6199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6199_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 15 - 265
Target Start/End: Complemental strand, 38439509 - 38439259
Alignment:
| Q |
15 |
atcatcatgcaaaatgtacatagcaggaactcggttggaaacatggttgagcttattctaattgcatacatagtggcaagtcagagtaacaaaaaagaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38439509 |
atcatcatgcaaaatgtacatagcaggaactcggttcgaaacatggttgagcttattctaattacatacatagtggcaagtcagagtaacaaaaaagaca |
38439410 |
T |
 |
| Q |
115 |
aagatgttaattagtgagtgaaaacattgtattgttcatattgaatgatcaacgatacccaagctaaaatcgagtggtcacatgtgtttagtttgatagt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38439409 |
aagatgttaattagtgagtgaaaacattgtattgttcatattgaatgatcaacgatacccaagctaaaatcgagtggtcacatgtgtttagtttgatagt |
38439310 |
T |
 |
| Q |
215 |
gtctaaatatagcattataatagcactggttcataagctacccttgtaact |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38439309 |
gtctaaatatagcattataatagcactggttcataagctacccttgtaact |
38439259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University