View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6199_low_18 (Length: 265)
Name: NF6199_low_18
Description: NF6199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6199_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 43 - 239
Target Start/End: Complemental strand, 1350875 - 1350678
Alignment:
| Q |
43 |
aacaacaacaagacgaaagcaaataataatgagtaaaatgaataggg-tgggttgcaactagatgacaaacctctgatatagcggaaatcaaagggtgta |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1350875 |
aacaacaacaagacgaaagcaaataataatgagtaaaatgaataggggtgggttgcaactagatgacaaacctctgatatagcggaaatcaaagggtgta |
1350776 |
T |
|
| Q |
142 |
tgcctagtgttttgagacagttctgagaacatggcgatgatagaaagtgagtgagtgacgcaaactggtgtctatgtcgtcgacggcaaaaggctggg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1350775 |
tgcctagtgttttgagacagttctgagaacatggcgatgatagaaagtgagtgagtgacgcaaactggtgtctatgtcgtcgacggcaaaaggctggg |
1350678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University