View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6199_low_24 (Length: 242)
Name: NF6199_low_24
Description: NF6199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6199_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 82 - 222
Target Start/End: Original strand, 28192211 - 28192351
Alignment:
| Q |
82 |
taatattttaggtctccaatactcttgtgaagtactgtaaatacgaatccaaacctagactgacgattttttgttgcttgctagggttgaagcccctgct |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28192211 |
taatattttaggtctccaatactcttgtgaagtactgtaaatacgaatccaaacctagactgatgattttttgttgcttgctagggttgaagcccctgct |
28192310 |
T |
|
| Q |
182 |
tcaaagtaagggtatgaaaaatcgagggttgaggttccatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28192311 |
tcaaagtaagggtatgaaaaatcgagggttgaggttccatg |
28192351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 28191848 - 28191915
Alignment:
| Q |
17 |
aatatacgaacaaa-tgaccaaattatctattgaacaggggttccaacactacttgcaatagaaaata |
83 |
Q |
| |
|
|||||||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28191848 |
aatatacgaataaagtgaccaaattatctatcaaacaggggttccaacactacttgcaatagaaaata |
28191915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 52 - 112
Target Start/End: Original strand, 26234457 - 26234517
Alignment:
| Q |
52 |
aggggttccaacactacttgcaatagaaaataatattttaggtctccaatactcttgtgaa |
112 |
Q |
| |
|
|||||| ||||||||||| ||||| | ||| || ||||||||||||||||||||||||||| |
|
|
| T |
26234457 |
aggggtgccaacactactagcaatggcaaacaaaattttaggtctccaatactcttgtgaa |
26234517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University