View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6199_low_25 (Length: 239)
Name: NF6199_low_25
Description: NF6199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6199_low_25 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 40775621 - 40775842
Alignment:
| Q |
18 |
taatcagaatcaaatgtgggtaactacgtaggcagatccttgtgtgaatgtggattaacatctgaatccaagtttggtgacagcacttgcaagccgtttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40775621 |
taatcagaatcaaatgtgggtaactacgtaggcagatccttgtgtgaatgtggattaacatctgaatccaagtttggtgacagcacttgcaatccgtttg |
40775720 |
T |
|
| Q |
118 |
acaactctaggattaggccttgataaaaattagaacaacatattggagaccagtagtttagtccaagtttcatgattcttacctgatcatagttcatgag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40775721 |
acaactctaggattaggccttgataaaaattagaacaacatattggagaccagtattttagtccaagtttcatgattcttacctgatcatagttcatgag |
40775820 |
T |
|
| Q |
218 |
ttcatcccacttcttcagagct |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40775821 |
ttcatcccacttcttcagagct |
40775842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University