View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6199_low_26 (Length: 239)
Name: NF6199_low_26
Description: NF6199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6199_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 2892357 - 2892591
Alignment:
| Q |
1 |
tgtcgaaagtgcaattggttcgaccccagattcttgcgttacttgtaccgttggttatgttcatgttccatgattcaccggtattgagtttcatgccacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
2892357 |
tgtcgaaagtgcaattggttcgaccccagattcttgcgttacttgtaccgttggttatgttcatgttccatgattcaccggtgttgagtttcatgccgcc |
2892456 |
T |
|
| Q |
101 |
accggggaaggctgcagcccatacggtgtagttgcatttgtttgtgatattgaatcttcctgcttgtgctgcagctatggatgttatggctatgagaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2892457 |
accggggaaggctgcagcccatacggtgtagttgcatttgtttgtgatattgaatcttcctgcttgtgctgcagctatggatgttatggctatgagaagg |
2892556 |
T |
|
| Q |
201 |
aagattgagagatttgttttcatgatgatgtccat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
2892557 |
aagattgagagatttgttttcatgatgatggccat |
2892591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University