View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6199_low_27 (Length: 237)
Name: NF6199_low_27
Description: NF6199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6199_low_27 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 52415657 - 52415420
Alignment:
| Q |
1 |
taatgttattttatgctaaatttaatatattatattaaagccatggcatgtcctataataataaatttaggcttaattgcacttttgaccccc-aagttt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52415657 |
taatgttattttatgctaaatttaatatattatattaaagccatggcatgtcctataataataaatttaggcttaattgcacttttgaccccccaagttt |
52415558 |
T |
|
| Q |
100 |
cagaattaagcgatttcggccaccaagtttaaaatgagcggttttgacacctcaacattaccccttttgcatttactaatcccaatgcacattctgacca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52415557 |
cagaattaagcgatttcggccaccaagtttaaaatgagcggttttgacacctcaacattaccccttttgcatttactaatcccaatgcacattctgacca |
52415458 |
T |
|
| Q |
200 |
aaaaacactagcgtgactaatttgatgatgtccatctc |
237 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
52415457 |
aaaaacactagcgtgactaatttaatgatgtgcatctc |
52415420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 55 - 92
Target Start/End: Complemental strand, 15204358 - 15204321
Alignment:
| Q |
55 |
ataataataaatttaggcttaattgcacttttgacccc |
92 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
15204358 |
ataataataattataggcttaattgcacttttgacccc |
15204321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University