View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6201_low_2 (Length: 386)
Name: NF6201_low_2
Description: NF6201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6201_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 6e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 212 - 369
Target Start/End: Complemental strand, 3840654 - 3840497
Alignment:
| Q |
212 |
aaggttcaagatgcagaatattttgaagaagatgaaggacctgaagccctaggagaagaagtaggaaaaagaggaagcaaacgaggttcagagtctctag |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3840654 |
aaggttcaagatgcagaatattttgaagaagatgaaggacctgaagccctaggagaagaagtaggaaaaagaggaagcaaacgaggttcagagtctctag |
3840555 |
T |
 |
| Q |
312 |
aagttgaagcagctctaggagaaggatgcagaaagaaacccttttctcttatagcttt |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3840554 |
aagttgaagcagctctaggagaaggatgcagaaagaaacccttttctcttatagcttt |
3840497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 7 - 147
Target Start/End: Complemental strand, 3840857 - 3840717
Alignment:
| Q |
7 |
tcgaagaatatattatttaaacaaaaatagttcaattcgatggtaaaataattcttgatccgactcgacaaaagattattgaattgtcttccataaaata |
106 |
Q |
| |
|
||||| || ||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3840857 |
tcgaacaaaatattatataaacaaaaatagttcaatttgaaggtaaaataattcttgatccgactcgacaaaagattattgaattgtcttccataaaata |
3840758 |
T |
 |
| Q |
107 |
aaacactaatacaaatcaatccatttcattagcaacaatgg |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3840757 |
aaacactaatacaaatcaatccatttcattagcaacaatgg |
3840717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University