View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6202_high_13 (Length: 245)
Name: NF6202_high_13
Description: NF6202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6202_high_13 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 11120691 - 11120930
Alignment:
| Q |
18 |
atatgtgcatatattccattttttcatttaatgagaggcttctatctcacac---------------ttttaatatctatagttattgtgaaaaaaccat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11120691 |
atatgtgcatatattccattttttcatttaatgagaggcttctatctcacacatgaaactccaacacttttaatatctatagttattgtgaaaaaaccat |
11120790 |
T |
 |
| Q |
103 |
tatattattattatttggggacaatatttgttttcataatttttcttccttttcagcatagtgaaagactttgcagcacaaagacttgatatatgtttct |
202 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11120791 |
tatatt---attatttggggacaatatttgttttcataatttttcttccttttcagcatagtgaaagactttgcagcacaaagacttgatatatgtttct |
11120887 |
T |
 |
| Q |
203 |
gcaagtgtggtgttggcgatcgatttggttgtggtttttctct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11120888 |
gcaagtgtggtgttggcgatcgatttggttgtggattttctct |
11120930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University