View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6202_low_16 (Length: 222)
Name: NF6202_low_16
Description: NF6202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6202_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 8 - 203
Target Start/End: Complemental strand, 45179275 - 45179081
Alignment:
| Q |
8 |
agtgagaagaagtaaagatccagtgtcaagtgagtagttcttagcttaagttatgaaatattaagtatatccgaaagttagttgcaatattgtgttgtgc |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45179275 |
agtgaaaagaagtaaagatccagtgtcaagtgagtagttcttagcttaagttatgaaatattaagtatatccg-aagttagttgcaatattgtgttgtgc |
45179177 |
T |
 |
| Q |
108 |
acaaatgtgttaccagaatctggatatgaatatgatatagcgatgattannnnnnncaaatataagataggatacataatatttataaattcataa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45179176 |
acaaatgtgttaccagaatctggatatgaatatgatttagggatgattatttttttcaaatataagataggatacataatatttataaattcataa |
45179081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University