View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6203_high_19 (Length: 388)
Name: NF6203_high_19
Description: NF6203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6203_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 372; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 1 - 380
Target Start/End: Original strand, 31641254 - 31641633
Alignment:
| Q |
1 |
tttgatgaggttggtgttggtggtattctacaccccccgtgaatgttagcatatcctttacatccaaggagtcaccaccatttcctccaccgttggtaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641254 |
tttgatgaggttggtgttggtggtattctacaccccccgtgaatgttagcatatcctttacatccaaggagtcaccaccatttcctccaccgttggtaag |
31641353 |
T |
 |
| Q |
101 |
gccaagaaagtccctagtgagaccatcgtcgttctttccggtgagacagcctctcatgttgttaatgtagtgatcaactgagtctagctgagtcactgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641354 |
gccaagaaagtccctagtgagaccatcgtcgttctttccggtgagacagcctctcatgttgttaatgtagtgatcaactgagtctagctgagtcactgat |
31641453 |
T |
 |
| Q |
201 |
ccaaactggccaatgctgagctgagaagtttgatggtgactcattgttggttggcttcctgtgatggcggccgcaccgacggttgctgctttttggagaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641454 |
ccaaactggccaatgctgagctgagaggtttgatggtgactcattgttggttggcttcctgtgatggcggccgcaccgacggttgctgctttttggagaa |
31641553 |
T |
 |
| Q |
301 |
gtgcagttgctgagaggtgtggtgacatggcagcactggaagaaggttgttgtgtgctgacgtggaagggtgatgatgtc |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641554 |
gtgcagttgctgagaggtgtggtgacatggcagcagtggaagaaggttgttgtgtgctgacgtggaagggtgatgatgtc |
31641633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University