View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6203_high_22 (Length: 331)
Name: NF6203_high_22
Description: NF6203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6203_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 18 - 321
Target Start/End: Original strand, 40793136 - 40793439
Alignment:
| Q |
18 |
tctagaacaccacactcaatcccatgctttttcttcctactactttttactaccaccaactcttatattccccttcatcnnnnnnnatcattcaaagttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40793136 |
tctagaacaccacactcaatcccatgctttttcttcctactactttttactaccaccaactcttatattccccttcatctttttttatcattcaaagttt |
40793235 |
T |
|
| Q |
118 |
ctttcactacnnnnnnncactctctaatcatgaccatgaacaaagttgataaatctcaagtaatagttctctctttcctagcttttctccttgtgatcac |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40793236 |
ctttcactactttttttcactctctaatcatgaccatgaacaaagttgataaatctcaagtaatagttctctctttcctagcttttctccttgtgatcac |
40793335 |
T |
|
| Q |
218 |
acccttcttaccttcttttcttaggcccagttacctttacttaatcttcaacctccttatcattgcacttggagctgaagctggacttctctcagtgttc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40793336 |
acccttcttaccttcttttcttaggcccagttacctttacttaatcttcaacctccttatcattgcacttggagctgaagctggacttctctcagtattc |
40793435 |
T |
|
| Q |
318 |
tctg |
321 |
Q |
| |
|
|||| |
|
|
| T |
40793436 |
tctg |
40793439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 147 - 298
Target Start/End: Original strand, 40785510 - 40785661
Alignment:
| Q |
147 |
atgaccatgaacaaagttgataaatctcaagtaatagttctctctttcctagcttttctccttgtgatcacacccttcttaccttcttttcttaggccca |
246 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||| || || | |||||||||||||||||||||| |||||||| | ||| ||||| | |
|
|
| T |
40785510 |
atgaccatgaacaaagttaataaatctcaagttatagttctctctatcttacttcttctccttgtgatcacacccttgttaccttcctctctcaggccta |
40785609 |
T |
|
| Q |
247 |
gttacctttacttaatcttcaacctccttatcattgcacttggagctgaagc |
298 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40785610 |
cttacctttacttaatcttcaacatccttatcattgcacttggagctgaagc |
40785661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University