View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6203_high_37 (Length: 240)
Name: NF6203_high_37
Description: NF6203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6203_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 43615340 - 43615119
Alignment:
| Q |
1 |
ccttgcccacaacgctccatgcagtccttcattactcctccttcattttcttacctgccccactgtgatttcactgttcttgaaatctaccctactcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43615340 |
ccttgcccacaacgctccatgcagtccttcattactcctccttcattttcttacctgccccactgtgatttcactgttcttgcaatctaccctactcaag |
43615241 |
T |
|
| Q |
101 |
attgctcaggattgcaccatgttgtttcagaattttgatctcagttagatcattcatgccctacatctacttatgggtcgattatattattcttcacaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43615240 |
attgctcaggattgcaccatgttgtttcagaattttgatctcagttagatcatgcatgccctacatctacttatgggtcgattatattattcttcacaca |
43615141 |
T |
|
| Q |
201 |
gtcacagtttacagtgcgatgt |
222 |
Q |
| |
|
|||||| ||||||||||||||| |
|
|
| T |
43615140 |
gtcacactttacagtgcgatgt |
43615119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University