View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6203_high_43 (Length: 233)
Name: NF6203_high_43
Description: NF6203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6203_high_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 45110622 - 45110395
Alignment:
| Q |
1 |
cggttgatcctttggtggttggtcgtgtgattggtgatgttgttgacatgttcatgccatctgttggcatgtctgtttactttggtcctaaacatgtcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45110622 |
cggttgatcctttggtggttggtcgtgtgattggtgatgttgttgacatgttcattccatctgttggcatgtctgtttactttggtcctaaacatgtcac |
45110523 |
T |
|
| Q |
101 |
aaatggttgcgacataaagccatccatggctatcaacccacccaaggtcactctcactggaaacatggataacctctacactctggtcagtcactcaatt |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45110522 |
aaatggttgtgacataaagccatccatggctatcaacccacccaaggtcactctcactggaaacatggataacctctacactctggtcagtcactcaatt |
45110423 |
T |
|
| Q |
201 |
gtatctc-ttgatcttgcatgcatatat |
227 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
45110422 |
gtatctctttgatcttgcatgcatatat |
45110395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University