View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6203_high_52 (Length: 201)
Name: NF6203_high_52
Description: NF6203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6203_high_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 17 - 189
Target Start/End: Original strand, 49614714 - 49614891
Alignment:
| Q |
17 |
acaaatccgtagaaggtggaagcatcggtggtgtatacgcagatagttccgtcgtcgttgggaagctcttcagcctgaaaaggtaaagggattaaaagag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49614714 |
acaaatccgtagaaggtggaagcatcggtggtgtatacgcagatagttccgtcgtcgttgggaagctcttcagcctgaaaaggtaaagggatt-aaagag |
49614812 |
T |
|
| Q |
117 |
aattgagaaaca----aactaaaaaagtagtggtgtgaattaat--gagataatggttacccagtaacgattttcttcg |
189 |
Q |
| |
|
| |||||||||| || |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
49614813 |
atttgagaaacaaaacaaaaaaaaaagtagtggtgtgaattaatgagagataatggttacccagtaacgatttacttcg |
49614891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University