View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6203_low_15 (Length: 441)
Name: NF6203_low_15
Description: NF6203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6203_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 86 - 389
Target Start/End: Complemental strand, 988045 - 987732
Alignment:
| Q |
86 |
gcgtgaattgaagtggcgtgaaacatacatctcatgaatgaattgaaacatctaaaggtaaaggtgtgtggttagagggaatggaggagaggaggaaaat |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
988045 |
gcgtgaattgaagtggcgtgaaacatacatctcatgaatgaattgaaacatctaaggataaaggtgtgtggttagagggaatggaggagaggaggaaaat |
987946 |
T |
|
| Q |
186 |
attttaaatttgactactttttaattcaattatttgaaagatgaaaggtt----------aagaaaatatctctcaaagtcaattttatctctctttcat |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
987945 |
attttaaatttgactactttttaattcaattatttggaagatgaaaggttaagagaatggaagaaaatatctctcaaagtcaattttatctctctttcat |
987846 |
T |
|
| Q |
276 |
tagtgaagaatttagaaccgatagaatatttattgcatgtttaaacttacaaaaatactttggttatatagatttcaacaaactcaacaaattgcatcat |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
987845 |
tagtgaagaatttagaaccgatagaatatttgttgcatgtttagacttacaaaaatactttggttacacagatttcaacaaactcaacaaattgcatcat |
987746 |
T |
|
| Q |
376 |
tttgtaggttgata |
389 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
987745 |
tttgtagattgata |
987732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 40 - 92
Target Start/End: Complemental strand, 988076 - 988024
Alignment:
| Q |
40 |
ggatgaaatgatattgtcctaaatcaattatgcgtgaattgaagtggcgtgaa |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
988076 |
ggatgaaatgatattgtcctaaatcaattatgcgtgaattgaagtggcgtgaa |
988024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University