View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6203_low_21 (Length: 365)
Name: NF6203_low_21
Description: NF6203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6203_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 17 - 356
Target Start/End: Complemental strand, 5148391 - 5148052
Alignment:
| Q |
17 |
gatgtatgagatctatctagtctagtatagataaagatcaagttgaatgtgggcctaggaagtacatgctttcgctttcatattaggctgtaagagtctt |
116 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5148391 |
gatgcatgagatctatctagtctagtatagataaagatcaagttgaatgtgggcctaggaagtacatgcgttcgctttcatattaggctgtaagagtctt |
5148292 |
T |
 |
| Q |
117 |
cttttgttgatttagacatgcaagatataattttccagaagaaggtgaattttcaaatgagaccctttgatgtgtatatataggccacactgacttcgta |
216 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5148291 |
cttttgttgatttggacatgcaagatataattttccagaagaaggtgaattttcaaatgagaccctttgatgtgtatatataggccacactgacttcgta |
5148192 |
T |
 |
| Q |
217 |
tttttgtctagatgtatttatcattgcccatgtgacaaataagacaatataacaattgaaattgaattgaattggagctatatatgtcaccctaggtccc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5148191 |
tttttgtctagatgtatttatcattgcccatgtgacaaataagacaatataacaattgaaattgaattgaattggagctatatatgtcaccctaggtccc |
5148092 |
T |
 |
| Q |
317 |
cgctacatggccctcacaaatcaattcataatagtattat |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5148091 |
cgctacatggccctcacaaatcaattcataatagtattat |
5148052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University