View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6203_low_43 (Length: 236)
Name: NF6203_low_43
Description: NF6203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6203_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 16 - 230
Target Start/End: Original strand, 6615620 - 6615833
Alignment:
| Q |
16 |
atttcctccgcccctaacgtaatcaataaacgacccataagtcataaccatttttgttgtcacaatgttcacctatggtcctattaaaattggaacttcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
6615620 |
atttcctccgcccctaacgtaatcaataaacgacccataagtcataaccattttagttgtcacaatgttcacctatggtcctactaaaattggtacttcc |
6615719 |
T |
 |
| Q |
116 |
tcgggctttaattaaaatactatttnnnnnnnngtatttattaatgtttttaattatactcttgttaatattatcaattatcttataatatcgactcgat |
215 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6615720 |
tcgggctttaattaaaatactatttaaaaaaaa-tatttattaatgtttttaattatactcttgttagtattatcaattatcttataatatcgactcgat |
6615818 |
T |
 |
| Q |
216 |
gatattttcatattt |
230 |
Q |
| |
|
||||| | ||||||| |
|
|
| T |
6615819 |
gatatatccatattt |
6615833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University