View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6203_low_44 (Length: 233)

Name: NF6203_low_44
Description: NF6203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6203_low_44
NF6203_low_44
[»] chr8 (1 HSPs)
chr8 (1-227)||(45110395-45110622)


Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 45110622 - 45110395
Alignment:
1 cggttgatcctttggtggttggtcgtgtgattggtgatgttgttgacatgttcatgccatctgttggcatgtctgtttactttggtcctaaacatgtcac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
45110622 cggttgatcctttggtggttggtcgtgtgattggtgatgttgttgacatgttcattccatctgttggcatgtctgtttactttggtcctaaacatgtcac 45110523  T
101 aaatggttgcgacataaagccatccatggctatcaacccacccaaggtcactctcactggaaacatggataacctctacactctggtcagtcactcaatt 200  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45110522 aaatggttgtgacataaagccatccatggctatcaacccacccaaggtcactctcactggaaacatggataacctctacactctggtcagtcactcaatt 45110423  T
201 gtatctc-ttgatcttgcatgcatatat 227  Q
    ||||||| ||||||||||||||||||||    
45110422 gtatctctttgatcttgcatgcatatat 45110395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University