View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6203_low_45 (Length: 225)
Name: NF6203_low_45
Description: NF6203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6203_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 15 - 209
Target Start/End: Original strand, 19276707 - 19276902
Alignment:
| Q |
15 |
atgaaaataaggtttt-tctttggtgtattttcaatttcaaacatagggaggttcaaaatcaggaggagaaagtactgattcaggatcaacagagctaca |
113 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19276707 |
atgaaaataaggttttgtttttggtgtattttcaatttcaaacatagggaggttcaaaatcaggaggagaaagtactgattcaggatcaacagagctaca |
19276806 |
T |
|
| Q |
114 |
atttgaaacagattctccaataagtgtaaaagcatcttcttcagatcatcataatcatgcttttcaacaggagacagcaactgatgatggattaag |
209 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19276807 |
atttgaaacaaattctccaataagtgtaaaagcatcttcttcagatcatcataatcatgcttttcaacaggagacagcaactgatgatggattaag |
19276902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University