View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6203_low_46 (Length: 225)
Name: NF6203_low_46
Description: NF6203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6203_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 112 - 190
Target Start/End: Complemental strand, 19828802 - 19828724
Alignment:
| Q |
112 |
ttgtgagggaatgaatggggtgaggaaaggaaggaaatgaaacagcctgaggaagggaaggaaacaaatgaatgaactt |
190 |
Q |
| |
|
||||||| | |||||||| |||||||| |||||||| |||||| | |||||||| |||||||| |||||||||||||| |
|
|
| T |
19828802 |
ttgtgagtggatgaatggtgtgaggaagagaaggaaacgaaacaacgtgaggaagagaaggaaagaaatgaatgaactt |
19828724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 49
Target Start/End: Original strand, 19829059 - 19829092
Alignment:
| Q |
16 |
cagtgattagagtaattacagtgataatttgaag |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19829059 |
cagtgattagagtaattacagtgataatttgaag |
19829092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 48
Target Start/End: Complemental strand, 50232367 - 50232338
Alignment:
| Q |
19 |
tgattagagtaattacagtgataatttgaa |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
50232367 |
tgattagagtaattacagtgataatttgaa |
50232338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University