View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6203_low_50 (Length: 208)
Name: NF6203_low_50
Description: NF6203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6203_low_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 16 - 193
Target Start/End: Original strand, 26156056 - 26156240
Alignment:
| Q |
16 |
ttaacatacataatatgaacaggatcataaatttaggtgaaccaaactaccttaactacttaagatattggtgagagtgagac-------ttttaaggtc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26156056 |
ttaacatacataatatgaacaggatcataaatttaggtgaaccaaactaccttaactacttaagatattggtgagagtgagacggtggacttttaaggtg |
26156155 |
T |
 |
| Q |
109 |
gtttttggaatcaaatatttgtccgtgttataaacgaatcataaaagtccaaaaatctgactagactaagctatagttttctctg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26156156 |
gtttttggaatcaaatatttgtccgtgttataaacgaatcaaaaaagtccaaaaatctgactagactaagctatagttttctctg |
26156240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University