View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6204_high_14 (Length: 207)

Name: NF6204_high_14
Description: NF6204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6204_high_14
NF6204_high_14
[»] chr8 (1 HSPs)
chr8 (19-88)||(27844388-27844457)


Alignment Details
Target: chr8 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 27844388 - 27844457
Alignment:
19 tctttgaaaggatcattctatttcatcaatttcatttttgtatactcatcctcatggctgtttagaaata 88  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||    
27844388 tctttgaaaggatcattctatttcatcaatttcatttttgtatactcatcctcatagctatatagaaata 27844457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University