View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6204_high_8 (Length: 244)
Name: NF6204_high_8
Description: NF6204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6204_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 26 - 237
Target Start/End: Complemental strand, 7150296 - 7150086
Alignment:
| Q |
26 |
ccgccgtggctttaacttaaaaccgccgcaaatagtgttctttatggtgcatagaatcatagtcgtaatggaagagcannnnnnnnaccaaattaatgga |
125 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
7150296 |
ccgccgtggctttaacttataacctccgcaaatagtgttctttatggtgcagagaatcatagtcgtaatggaagagcattttttttaccaa-ttaatgga |
7150198 |
T |
|
| Q |
126 |
atcgcataatgcttcattattttgatactttgtaaactaatagaataaaatggaaaatgatagcatctttactagtacaatgaaaaacatctcgaataga |
225 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7150197 |
atcgcataatgctccattattttgatactttgtaaactaatagaataaaatggaaaatgatagcatctttactagtacaatgaaaaacatctcgaataga |
7150098 |
T |
|
| Q |
226 |
atgcggcctttg |
237 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7150097 |
atgcggcctttg |
7150086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University