View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6204_low_11 (Length: 238)
Name: NF6204_low_11
Description: NF6204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6204_low_11 |
 |  |
|
| [»] scaffold0636 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 56 - 221
Target Start/End: Complemental strand, 16410323 - 16410158
Alignment:
| Q |
56 |
acatgagatttgcatttgacctcctacttacttggtcaatgttgttcttcaatcctatttgttattgagattgcatcagatatgaatctgaagtcctttt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16410323 |
acatgagatttgcatttgacctcctacttacttggtcaatgttgttcttcaatcctatttgttattgagattgcatcagatatgaatctgaagtcctttt |
16410224 |
T |
 |
| Q |
156 |
tagtccttctgaacacatatctaatgtttagaatttatgtttccttggatatctatgcatttgcac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16410223 |
tagtccttctgaacacatatctaatgtttagaatttatgtttccttggatatctatgcatttgcac |
16410158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 16410355 - 16410323
Alignment:
| Q |
1 |
tttctaatgtctattttaaagtcatttttatca |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
16410355 |
tttctaatgtctattttaaagtcatttttatca |
16410323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0636 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0636
Description:
Target: scaffold0636; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 109
Target Start/End: Complemental strand, 6622 - 6566
Alignment:
| Q |
53 |
ttgacatgagatttgcatttgacctcctacttacttggtcaatgttgttcttcaatc |
109 |
Q |
| |
|
|||||||||||| | | ||||| |||||| || |||||||||| ||||||||||||| |
|
|
| T |
6622 |
ttgacatgagatctacttttgatctcctattttcttggtcaatcttgttcttcaatc |
6566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University