View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6204_low_13 (Length: 213)
Name: NF6204_low_13
Description: NF6204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6204_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 41451654 - 41451461
Alignment:
| Q |
1 |
ttttaactatactggatatatatgcttggactttgaattaaacagaaaaagatatctttcagagaaagctatagggtgcgatttgtatgatcgtgtaatt |
100 |
Q |
| |
|
|||||||| |||| | || ||||||||| |||||||||||||||| |||||||||||| | |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41451654 |
ttttaactgtactaggtacatatgcttgaactttgaattaaacagcaaaagatatcttcctgagaaacctatagggtgcgatttgtatgatcgtgtaatt |
41451555 |
T |
 |
| Q |
101 |
taatatgcttgtgtgtcgcgttgttcaacccgcgttggtgtccaatgtatgacacnnnnnnnatacatgtcaaaatcctcatacaagtattcaa |
194 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
41451554 |
taatatgcttgtgtgtcgcggtgttcaacccgcgttggtgtccaatgtatgacactttttttatacatgtcaaaaacctcatacaagtattcaa |
41451461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University