View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6204_low_4 (Length: 281)
Name: NF6204_low_4
Description: NF6204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6204_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 5 - 266
Target Start/End: Complemental strand, 26621273 - 26621007
Alignment:
| Q |
5 |
aggtgaacgattgctgcttccctagtctgaatcatctggaggtttgttgcctcctcctcgacgcgacttcatcggaatcgaaacggcatctgcaatcacc |
104 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
26621273 |
aggtgaatgattgctgcttccctagtctgaatcatctggaggtttgtcgcctcctcctcgacgcaacttcatcagaatcgaaacggcatctgcaatcacc |
26621174 |
T |
 |
| Q |
105 |
actggagtggagtttcactggttttgttatgctacttcaagctgcatagcaatctccatagggatatttacttgattttcttccattcgcctaagtcttt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26621173 |
actggagtggagtttcactggttttgttatgctacttcaagctgcatagcaatctccgtagggatatttacttgattttcttccattcgcctaagtcttt |
26621074 |
T |
 |
| Q |
205 |
cattttgttgctgaaatagattccgaaggct-----agagtttgttagtgcctggaggtggtggaag |
266 |
Q |
| |
|
|||| ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26621073 |
cattctgttgctgaaatagattccaaaggcttcttaagagtttgttagtgcctggaggtggtggaag |
26621007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University