View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6206_low_2 (Length: 225)
Name: NF6206_low_2
Description: NF6206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6206_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 21 - 136
Target Start/End: Complemental strand, 32881225 - 32881110
Alignment:
| Q |
21 |
acaggcctttcatataaactttgaataacacgatgagaatgaagggtgcactgtacctttggttttatctggatcgtgctaacagtctttaattttttat |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32881225 |
acaggcctttcatataaactttgaataacacgatgagaatgaaggttgcactgtacctttggttttatctggatcgtgctaacagtctttaattttttat |
32881126 |
T |
|
| Q |
121 |
tagaaaacgacacaga |
136 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32881125 |
tagaaaacgacacaga |
32881110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 163 - 211
Target Start/End: Complemental strand, 32881084 - 32881036
Alignment:
| Q |
163 |
gctaggtttgttgtttttggctttactattgatagattttgatattctt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32881084 |
gctaggtttgttgtttttggctttactattgatagattttgattttctt |
32881036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University