View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6207_low_1 (Length: 315)
Name: NF6207_low_1
Description: NF6207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6207_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 17 - 307
Target Start/End: Complemental strand, 10381348 - 10381058
Alignment:
| Q |
17 |
aattcatgtatgaactggaaccagtttccttgagccttcaagggctccatctatctaaggtctaagggaccatacattgctgtccaattcattttttctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10381348 |
aattcatgtatgaactggaaccagtttccttgagccttcaagggctccatctatctaaggtctaagggaccatacattgctgtccaattcattttttctt |
10381249 |
T |
 |
| Q |
117 |
atcaatgatgtaacatgcatttcataacgtagttgtgtaatacattttggtggccactgctaaacaaaggttatagtaccattatttaatgcagacttta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10381248 |
atcaatgatgtaacatgcatttcataacgtagttgtgtaatacattttggtggccactactaaacaaaggttatagtaccattatttaatgcagacttta |
10381149 |
T |
 |
| Q |
217 |
gatacataataacttttaatttcaaactttaaaattttaatcaatagtgggaccgacccatgtctcttatagcctccttagtccctatgct |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10381148 |
gatacataataacttttaatttcaaactttaaaattttaatcaatagtgggaccgacccatgtctcttatagcctccttagtccttatgct |
10381058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University